Sequence ID | >WENV170644516 |
Genome ID | JMBW01022794 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 253 |
End posion on genome | 329 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
aacattcttG |
tRNA gene sequence |
GGGGGGATCGTCTAACGGCAGGACAGTGGACTCTGACTCCACGAGTAGAGGTTCGAATCC |
Downstream region at tRNA end position |
Ataaaaaaaa |
Secondary structure (Cloverleaf model) | >WENV170644516 Gln CTG G AGCC Ataaaaaaaa G - C G - C G - C G - C G - C G - C A C C T T T T C T C A A A C + | | + A C T C T G G A G G T G G + | | | T C G G G A C C A A GAGTA G - C T - A G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |