Sequence ID | >WENV170644527 |
Genome ID | JMBW01024847 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 366 |
End posion on genome | 442 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gcacgccatG |
tRNA gene sequence |
GTGGTTGTGGCGAAGTGGTTAACGCACCGGATTGTGGCTCCGGCATTCGTGGGTTCAAAT |
Downstream region at tRNA end position |
ccaatttaga |
Secondary structure (Cloverleaf model) | >WENV170644527 His GTG G CCCC ccaatttaga G - C T - A G - C G - C T + G T - A G - C T A T T A C C C A T G A G + | | | | A G A G C G G T G G G C G | | | T T T A C G C T A A CATTC C - G C - G G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |