Sequence ID | >WENV170644528 |
Genome ID | JMBW01024847 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 451 |
End posion on genome | 526 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccccaattta |
tRNA gene sequence |
GAGCCATTAGCTCAGTCGGCAGAGCACCTGACTTTTAATCAGGGGGTCCCGCGTTCGAGT |
Downstream region at tRNA end position |
cttaatcttt |
Secondary structure (Cloverleaf model) | >WENV170644528 Lys TTT a ACCA cttaatcttt G - C A - T G - C C - G C - G A - T T - A T G T G G C G C A T G A A | | | | | G C C T C G C C G C G C G | | | | T T G G A G C C A A GGGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |