Sequence ID | >WENV170644529 |
Genome ID | JMBW01025020 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 130 |
End posion on genome | 54 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tggcagctat |
tRNA gene sequence |
GCGCCCGTGGTGAAAGGGATATCACGCAGGCCTCCGGAGCCTGAAGTCGGGGGGTTCGAA |
Downstream region at tRNA end position |
cttttacaat |
Secondary structure (Cloverleaf model) | >WENV170644529 Arg CCG t ACCA cttttacaat G + T C - G G - C C - G C - G C - G G - C T A T G T C C C A G A A G + | | | G G A G T G G G G G G C G | | | | T T A T C A C T A G AAGTCG C - G A - T G - C G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |