Sequence ID | >WENV170644530 |
Genome ID | JMBW01025243 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 346 |
End posion on genome | 271 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
taggcgccga |
tRNA gene sequence |
GGTGCGGTGGCGAAGTGGCTAACGCCGTGGTCTGCAAAACCATTATGCGCCGGTTCAAAT |
Downstream region at tRNA end position |
ttattatgcc |
Secondary structure (Cloverleaf model) | >WENV170644530 Cys GCA a TCCA ttattatgcc G - C G - C T - A G - C C - G G - C G - C T A T C G G C C A T G A G | | | | | A G A G C G G C C G G C G | | | T T C A C G C T A C TATGC G + T T - A G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |