Sequence ID | >WENV170644537 |
Genome ID | JMBW01026609 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 477 |
End posion on genome | 404 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agcttatagt |
tRNA gene sequence |
GGCGGCATAGCCAAGTGGTAAGGCAGAGGACTGCAAATCCTTTACCCCCGGTTCAAATCC |
Downstream region at tRNA end position |
gataaccttc |
Secondary structure (Cloverleaf model) | >WENV170644537 Cys GCA t TCCA gataaccttc G - C G - C C - G G - C G - C C - G A - T T A T G G G C C A G A A | | | | | A T A C C G C C C G G C G | | | T T G A G G C T A A TACC G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |