Sequence ID | >WENV170644539 |
Genome ID | JMBW01026680 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 207 |
End posion on genome | 129 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tgaagacgcC |
tRNA gene sequence |
CCCCCAGTGGCTCAATGGATAGAGCAAGGCACTCCTAACGCCTAGAGTTGGGGGGGGTTC |
Downstream region at tRNA end position |
tgaaaaaaaa |
Secondary structure (Cloverleaf model) | >WENV170644539 Arg CCT C GGta tgaaaaaaaa C - G C - G C - G C - G C - G A - T G - C T T T C T C C C A T A A G | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T A A AGAGTTGGG A - T G - C G - C C - G A C C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |