Sequence ID | >WENV170644540 |
Genome ID | JMBW01026983 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 522 |
End posion on genome | 448 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gcggccgatT |
tRNA gene sequence |
CTCTCCGTAGCTCAGGTGGCAGAGCAGATGACTCTTAATCATCGGGTCGAAGGTTCGAGT |
Downstream region at tRNA end position |
tcaacctaaa |
Secondary structure (Cloverleaf model) | >WENV170644540 Lys CTT T AGac tcaacctaaa C - G T + G C - G T + G C - G C - G G - C T G T C T T C C A G G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C C A A GGGTC G - C A - T T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |