Sequence ID | >WENV170644542 |
Genome ID | JMBW01027208 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 157 |
End posion on genome | 237 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aaattatttt |
tRNA gene sequence |
GGCCCGTTCGTCTAGGGGGGGTTAGGACGTCAGGTTTTCATCCTGGTAACAGGGGGGGTT |
Downstream region at tRNA end position |
cgtcttattt |
Secondary structure (Cloverleaf model) | >WENV170644542 Glu TTC t GCAA cgtcttattt G + T G - C C - G C - G C - G G - C T - A T T T T C C C C A G G G A C + | | | | G G T C T G G G G G G C G + | | | T T G G G A C G T T A G TAACAGG T + G C - G A - T G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |