Sequence ID | >WENV170644545 |
Genome ID | JMBW01029077 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 236 |
End posion on genome | 162 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tagattacga |
tRNA gene sequence |
GCGGATGTAGCCCAGTGGTAGGGCAACGGCTTCCCAAGCCGTGAGTCGCGGGTTCGAATC |
Downstream region at tRNA end position |
tttattttcc |
Secondary structure (Cloverleaf model) | >WENV170644545 Gly CCC a TCCA tttattttcc G - C C - G G - C G - C A - T T - A G - C T A T T G C C C A G A A + | | | | G T C C C G G C G G G C G | | | | T T G G G G C T A A GAGTC A - T C - G G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |