Sequence ID | >WENV170644546 |
Genome ID | JMBW01029345 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 106 |
End posion on genome | 19 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttttcaaatt |
tRNA gene sequence |
GCTGAGGTAGCCAAGTGGACTACGGCGCCGGTCTTGAAAACCGGTAGCGCTTCGCGCTAC |
Downstream region at tRNA end position |
aatcctgagt |
Secondary structure (Cloverleaf model) | >WENV170644546 Ser TGA t GCTA aatcctgagt G - C C - G T - A G - C A - T G - C G - C T A T T C C T C A T G A A + | | | | G G A C C G G G G A G C G | | | T T A C G G C C T A G TAGCGCTTCGCGCTAC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |