Sequence ID | >WENV170644547 |
Genome ID | JMBW01029485 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 146 |
End posion on genome | 60 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
acgccacggg |
tRNA gene sequence |
GGGAAGGGTGTCCGAGCGGTTTAAGGAGCTGGTCTTGAAAACCAGTGACTCGTAAGAGCC |
Downstream region at tRNA end position |
tactgcgcga |
Secondary structure (Cloverleaf model) | >WENV170644547 Ser TGA g CCAt tactgcgcga G G G - C G - C A - T A - T G - C G - C T A G C A C C C A C G A G T | | | | | G G C C T G G T G G G C G | + T T T A G G A T T A G TGACTCGTAAGAGCC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |