Sequence ID | >WENV170644549 |
Genome ID | JMBW01029561 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 52 |
End posion on genome | 129 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
attatggtaa |
tRNA gene sequence |
AGGGGTGTAGTTCAGTGGCAGAACGTCGGTCTCCAAAACCGAATGTCGTGGGTTCAAATC |
Downstream region at tRNA end position |
tacatattaa |
Secondary structure (Cloverleaf model) | >WENV170644549 Trp CCA a GCCA tacatattaa A - T G - C G - C G - C G - C T C G - C T C T C A C C G C G A A | | T T C T T G G G T T C A G | | | | A A G G A A C C A G ATGTCGTG T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |