Sequence ID | >WENV170644553 |
Genome ID | JMBW01029581 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 419 |
End posion on genome | 343 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
attaagtttt |
tRNA gene sequence |
GGCGGTGTAGCTCAGCTGGCTAGAGCATGCGGTTCATACCCGCAGTGTCCGGGGTTCGAG |
Downstream region at tRNA end position |
ttttttttgt |
Secondary structure (Cloverleaf model) | >WENV170644553 Met CAT t ACCA ttttttttgt G + T G - C C - G G - C G - C T - A G - C T G T G T C C C A C G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C C T A A GTGTC T - A G - C C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |