Sequence ID | >WENV170644562 |
Genome ID | JMBW01030456 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 229 |
End posion on genome | 152 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
taatactatg |
tRNA gene sequence |
GCCCCCATGGTCAAGAGGTTAAGATATCGCCCTCTCACGGCGAAGTCAGGGGGGGTTCGA |
Downstream region at tRNA end position |
ccaataaggt |
Secondary structure (Cloverleaf model) | >WENV170644562 Glu CTC g GCTA ccaataaggt G G C - G C - G C - G C - G C - G A - T T T T T C C C C A A G A G + | | | | G G A C T G G G G G G C G | | + T T T A G A T T A A AGTCAGG T - A C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |