Sequence ID | >WENV170644571 |
Genome ID | JMBW01032115 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 225 |
End posion on genome | 300 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gctagtactT |
tRNA gene sequence |
GGTGGGATAGCTCAGTTGGTTAGAGCATGGGATTCATAAACCCAAGGTCGGTGGTTCGAT |
Downstream region at tRNA end position |
tttaaagata |
Secondary structure (Cloverleaf model) | >WENV170644571 Met CAT T ATac tttaaagata G - C G - C T - A G - C G - C G - C A - T T T T T C A C C A T G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A A AGGTC T - A G - C G - C G - C A A T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |