Sequence ID | >WENV170644573 |
Genome ID | JMBW01032457 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 11 |
End posion on genome | 87 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ctccatccga |
tRNA gene sequence |
GGCGACATAGCCAAGTGGTAAGGCAGAGGACTGCAAATCCTTTATCCCCCCCGGTTCGAA |
Downstream region at tRNA end position |
ttttttttgc |
Secondary structure (Cloverleaf model) | >WENV170644573 Cys GCA a TCCA ttttttttgc G - C G - C C - G G - C A - T C - G A - T T A T G G G C C A G A A | | | | | G T A C C G C C C G G C G | | | T T G A G G C T A A TATCCCC G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |