Sequence ID | >WENV170644574 |
Genome ID | JMBW01032457 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 96 |
End posion on genome | 184 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
catttttttt |
tRNA gene sequence |
GCCGGGGTGGCGGAACAGGCAGACGCAAGGGACTTAAAATCTCGGGTGATACAATACTCG |
Downstream region at tRNA end position |
ttacttttca |
Secondary structure (Cloverleaf model) | >WENV170644574 Leu TAA t ACCA ttacttttca G - C C - G C - G G - C G - C G - C G + T T G T T G G C C A C A A G | | | | | G A G G C G A C C G G C G | | | T T G A C G C C A G A GGTGATACAATACTCGT A G G - C G + T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |