Sequence ID | >WENV170644581 |
Genome ID | JMBW01033021 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 291 |
End posion on genome | 367 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaaaatatat |
tRNA gene sequence |
CGCGGGATGGAGCAGTATGGTAGCTCGTCGGGCTCATAACCCGGAGGTCATAGGTTCAAA |
Downstream region at tRNA end position |
taattttctt |
Secondary structure (Cloverleaf model) | >WENV170644581 Met CAT t ACCA taattttctt C A G - C C - G G - C G - C G - C A - T T A T T A T C C A T G A G | | | | | A A C G A G A T A G G C T | | | | T T G G C T C G T A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |