Sequence ID | >WENV170644583 |
Genome ID | JMBW01033260 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 89 |
End posion on genome | 5 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttcatcacca |
tRNA gene sequence |
GGGGGCGTGGTGGAACTGGCAGACACGCTTGACTTAGGATCAAGTACTTCACGGTGTGCA |
Downstream region at tRNA end position |
tattnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170644583 Leu TAG a ACCA tattnnnnnn G - C G - C G - C G - C G - C C - G G - C T G T T G T C C A C A A G + | | | | G T G G T G G C A G G C G | | | T T G A C A C C A G G TACTTCACGGTGT C - G T - A T - A G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |