Sequence ID | >WENV170644584 |
Genome ID | JMBW01033399 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 161 |
End posion on genome | 85 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttcaaacgg |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGGAGGTTGTCGGTTCAAA |
Downstream region at tRNA end position |
atttttcaaa |
Secondary structure (Cloverleaf model) | >WENV170644584 Met CAT g ACCA atttttcaaa C A G - C C - G G - C G - C G - C G - C T A T C G G C C A T G A G | + | | | A C C G A G G T C G G C T | | | | T T G G C T C G T A G AGGTT T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |