Sequence ID | >WENV170644585 |
Genome ID | JMBW01034998 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 187 |
End posion on genome | 264 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ttttaagcgg |
tRNA gene sequence |
GGGGGTGTAGCTCAGCTGGGAGAGCACCTGCCTTGCAAGCAGGGGGGGTCAGCGGTTCGA |
Downstream region at tRNA end position |
tggaggcagt |
Secondary structure (Cloverleaf model) | >WENV170644585 Ala TGC g ACCA tggaggcagt G - C G - C G + T G - C G + T T - A G - C T A T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A A GGGGGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |