Sequence ID | >WENV170644590 |
Genome ID | JMBW01036569 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 153 |
End posion on genome | 79 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tatgcgacat |
tRNA gene sequence |
GCGCCCGTAGCTCAGTGGATAGAGCACTGGCCTCCGGAGCCAGGAGCGGAGGTTCGATTC |
Downstream region at tRNA end position |
tatgcttact |
Secondary structure (Cloverleaf model) | >WENV170644590 Arg CCG t ACCA tatgcttact G + T C - G G - C C - G C - G C - G G - C T T T T C T C C A T G A A + | | | | G G C T C G G G A G G C G | | | | T T A G A G C T A A GAGC C - G T - A G - C G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |