Sequence ID | >WENV170644592 |
Genome ID | JMBW01036761 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 114 |
End posion on genome | 40 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
taccagtaaa |
tRNA gene sequence |
GGGACCGTAGGGTAGCTTGGTCCATCCTTCGGCGTTCGGGACGCCGGAACCTGAGTTCAA |
Downstream region at tRNA end position |
ccctattctt |
Secondary structure (Cloverleaf model) | >WENV170644592 Pro CGG a Attt ccctattctt G - C G - C G - C A - T C - G C - G G - C T A T G A C T C A T C G A A | | | | | A T T G G G C T G A G C G | | + T T G T C C T T C C A T GAAC C - G G - C G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |