Sequence ID | >WENV170644594 |
Genome ID | JMBW01037100 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 2 |
End posion on genome | 78 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
nnnnnnnnna |
tRNA gene sequence |
GGAGCCGTGGTGTAGTTGGTTAACACGTCGGCCTGTCACGCCGAAGATCGCGAGTTCGAG |
Downstream region at tRNA end position |
tcctttatca |
Secondary structure (Cloverleaf model) | >WENV170644594 Asp GTC a GCCA tcctttatca G - C G - C A - T G + T C - G C - G G - C T G T T G C T C A T G A G + | | | | G T T G T G G C G A G C G | | | | T T G A C A C T T A G AGATC T - A C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |