Sequence ID | >WENV170644596 |
Genome ID | JMBW01037222 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 104 |
End posion on genome | 180 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cgctccattt |
tRNA gene sequence |
GGTGCGGTGGCGAAGTTGGCTAACGCTGCGGACTGCAAATCCGCCATTCGTCGGTTCAAA |
Downstream region at tRNA end position |
acttaaaaat |
Secondary structure (Cloverleaf model) | >WENV170644596 Cys GCA t TCCA acttaaaaat G - C G - C T - A G - C C - G G - C G - C T A T C A G C C A T G A G | | | | | A T A G C G G T C G G C G | | | T T G A C G C C T A T CATTC G - C C - G G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |