Sequence ID | >WENV170644600 |
Genome ID | JMBW01037358 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 198 |
End posion on genome | 274 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
agcgctacgt |
tRNA gene sequence |
GGCCTGGTAGTTCAGTTGGTTAGAATGCTAGCCTGTCACGCTAGAGGTCGAGGGTTCGAG |
Downstream region at tRNA end position |
cttatttaac |
Secondary structure (Cloverleaf model) | >WENV170644600 Asp GTC t GCCA cttatttaac G - C G + T C - G C - G T - A G - C G - C T G T T T C C C A T G A A + | | | | G T C T T G G A G G G C G | | | + T T G G A A T T T A G AGGTC C - G T - A A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |