Sequence ID | >WENV170644601 |
Genome ID | JMBW01037710 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 207 |
End posion on genome | 284 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
attacaagcc |
tRNA gene sequence |
GCTCCGATAGTGTAGCTCGGCCAATCATTCAGGACTCTCACTCCTGCGACTGGGGGGGTT |
Downstream region at tRNA end position |
ttctttttac |
Secondary structure (Cloverleaf model) | >WENV170644601 Glu CTC c Attt ttctttttac G - C C - G T - A C - G C - G G - C A - T T A T A C C C C A T C G A A | | | | A C T G T G G G G G G C G | | + T T G T C A T C C A A T CGACTGG C - G A - T G - C G - C A - T C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |