Sequence ID | >WENV170644607 |
Genome ID | JMBW01039482 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 289 |
End posion on genome | 199 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
caatggtcat |
tRNA gene sequence |
GGAGAGGTGGCCGAGTTGGCTGAAGGCGCTCGCCTGGAAAGCGGGTAAACGTGAAAGCGT |
Downstream region at tRNA end position |
ttaggaaatt |
Secondary structure (Cloverleaf model) | >WENV170644607 Ser GGA t GCCA ttaggaaatt G - C G - C A - T G - C A - T G - C G + T T A T T T C C C A T T G A G | | | | | A G G C C G A A G G G C G | | | T T C A G G C T G A G TAAACGTGAAAGCGTTTC C - G T + G C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |