Sequence ID | >WENV170644610 |
Genome ID | JMBW01040226 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 324 |
End posion on genome | 399 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
ccttgtataT |
tRNA gene sequence |
GGGAATATAGCTCAGGAGGTCAGAGCACGGTTCTTATAAAGCCGAAGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
tttcattgat |
Secondary structure (Cloverleaf model) | >WENV170644610 Ile TAT T ATac tttcattgat G - C G - C G - C A - T A - T T - A A - T T G T C C A C C A G G A A | | | | | G A C T C G G G T G G C G | | | | T T G G A G C T C A A AAGTC C - G G - C G - C T + G T - A C A T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |