Sequence ID | >WENV170644611 |
Genome ID | JMBW01040744 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 205 |
End posion on genome | 282 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gagaccttgg |
tRNA gene sequence |
GGGGATGTAGCTTAGTCGGGAGAGCGCCTCCTTTGCAAGGAGGAGGTCAGGGGGGTTCGA |
Downstream region at tRNA end position |
gcagtttggc |
Secondary structure (Cloverleaf model) | >WENV170644611 Ala TGC g ACCA gcagtttggc G - C G - C G + T G - C A - T T - A G - C T G T T C C C C A T G A A + | | | | G C T T C G G G G G G C G + | | | T T G G A G C G A G AGGTCAG C - G C - G T - A C - G C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |