Sequence ID | >WENV170644613 |
Genome ID | JMBW01041198 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 241 |
End posion on genome | 317 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tttcctatgg |
tRNA gene sequence |
GGGGGCGTGGTGTAGCGGTTCAACATGCGGCCCTGTCAAGGCCGAGATCGCGGGTTCAAA |
Downstream region at tRNA end position |
aaagaaactg |
Secondary structure (Cloverleaf model) | >WENV170644613 Asp GTC g GCCT aaagaaactg G - C G - C G - C G + T G - C C - G G - C T A T T G C C C A C G A G + | | | | A G T G T G G C G G G C G | | | + T T T A C A T T C A G AGATC C - G G - C G - C C - G C - G C A T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |