Sequence ID | >WENV170644614 |
Genome ID | JMBW01041423 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 228 |
End posion on genome | 304 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
agcttgatac |
tRNA gene sequence |
GGGTGATTAGCTCAGCTGGTTAGAGTGCCTGCGTGACATGCAGGAGGCCATAGGTTCAAG |
Downstream region at tRNA end position |
taagtaaaga |
Secondary structure (Cloverleaf model) | >WENV170644614 Val GAC c ACCA taagtaaaga G - C G - C G - C T - A G - C A - T T - A T G T T A C C C A C G A A | | | | A T C T C G A T A G G C G | | | + T T G G A G T T T A G AGGCC C - G C - G T - A G - C C - G G T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |