Sequence ID | >WENV170644619 |
Genome ID | JMBW01042654 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 230 |
End posion on genome | 145 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ctccaggtcc |
tRNA gene sequence |
GCTCGGATGGTGGAATGGTAGACACGCAAGACTTAAAATCTTGTGGCCATTATAGGCTGT |
Downstream region at tRNA end position |
taaatggttg |
Secondary structure (Cloverleaf model) | >WENV170644619 Leu TAA c ACtc taaatggttg G + T C - G T - A C - G G - C G - C A - T T G T C G C C C A T A A G | | | | | A G G G T G G C G G G C G | | | T T T A C A C A G G TGGCCATTATAGGCTGT C - G A - T A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |