Sequence ID | >WENV170644628 |
Genome ID | JMBW01045082 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 221 |
End posion on genome | 132 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtttactgat |
tRNA gene sequence |
GGAGGGGTGTCCGAGCGGTTTAAGGAGCTGGTCTTGAAAACCAGTGACTCGAAAGAGCCG |
Downstream region at tRNA end position |
Agattaaact |
Secondary structure (Cloverleaf model) | >WENV170644628 Ser TGA t CGCC Agattaaact G - C G + T A C G - C G - C G - C G - C C C T C C C A C T C G A G | | | | A G G C C T G G G T T A G | | | C G T A G G A T T A G TGACTCGAAAGAGCCGT C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |