Sequence ID | >WENV170644631 |
Genome ID | JMBW01045929 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 247 |
End posion on genome | 162 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaataaatag |
tRNA gene sequence |
GCGGAAGTGGTGGAACTGGCAGACACGCTATCTTGAGGGGGTAGTGAACAATGTTCATGC |
Downstream region at tRNA end position |
gaaaacagat |
Secondary structure (Cloverleaf model) | >WENV170644631 Leu GAG g ACCA gaaaacagat G - C C - G G - C G - C A - T A - T G - C T A T C G C C C A C A A G | | | | | G T G G T G G C G G G C G | | | T T G A C A C C A G G TGAACAATGTTCAT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |