Sequence ID | >WENV170644634 |
Genome ID | JMBW01046285 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 31 |
End posion on genome | 108 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
atacaacctt |
tRNA gene sequence |
GGCCCCATAGTTCAAGGGATAGAACGGAAGTTTCCTAAACTTTAAATCCAGGTTCGAGTC |
Downstream region at tRNA end position |
aaacctcgcc |
Secondary structure (Cloverleaf model) | >WENV170644634 Arg CCT t ACCA aaacctcgcc G + T G - C C - G C - G C - G C - G A G T C T G G T G G C G A A A + | T G C T T G G G T T C G G | | | | G A A G A A C T A G AAATCCA G + T A - T A - T G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |