Sequence ID | >WENV170644636 |
Genome ID | JMBW01046520 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 190 |
End posion on genome | 266 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ccattattgg |
tRNA gene sequence |
GGGGGCGTAGCCAAGTCGGTAAGGCACTAGACTTTGACTCTAGCATCCCACAGGTTCGAG |
Downstream region at tRNA end position |
ctatgaccca |
Secondary structure (Cloverleaf model) | >WENV170644636 Gln TTG g GCCA ctatgaccca G A G - C G - C G - C G - C C - G G - C T G T T G T C C A T G A A | | | | | G C A C C G A C A G G C G | | | T T G A G G C T A A CATCCC C - G T - A A - T G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |