Sequence ID | >WENV170644637 |
Genome ID | JMBW01046520 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 271 |
End posion on genome | 346 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cagccactat |
tRNA gene sequence |
GACCCATTAGCTCAGCTGGCAGAGCACTTGACTTTTAATCAAGGAGTCCGGCGTTCGAAT |
Downstream region at tRNA end position |
atataatatt |
Secondary structure (Cloverleaf model) | >WENV170644637 Lys TTT t ACCA atataatatt G - C A - T C - G C - G C - G A - T T - A T A T G C C G C A C G A A | | | | | G T C T C G C G G C G C G | | | | T T G G A G C C A A GAGTC C - G T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |