Sequence ID | >WENV170644638 |
Genome ID | JMBW01046630 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 272 |
End posion on genome | 354 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
agtacgcgcG |
tRNA gene sequence |
GGGCCTATAGCTCAGTTAGGTAGAGCGCCTGGCTTTTAACCAGGTGGTCGGGGGGGGTTC |
Downstream region at tRNA end position |
Atgggcgatg |
Secondary structure (Cloverleaf model) | >WENV170644638 Lys TTT G TGCC Atgggcgatg G + T G G G - C C C C - G T + G A G C T T T T C C C A T G A A + + | | A T C T C G G G G G T A A | | | | T C G G A G C G T A G TGGTCGGGG C - G C - G T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |