Sequence ID | >WENV170644639 |
Genome ID | JMBW01046934 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 83 |
End posion on genome | 157 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gtctaaaaac |
tRNA gene sequence |
GCCGGCTTAGCTCAGTTGGTAGAGCATCTGATTTGTAATCAGGGGGGGTCGAGGGTTCAA |
Downstream region at tRNA end position |
gaatttgatt |
Secondary structure (Cloverleaf model) | >WENV170644639 Thr TGT c Attt gaatttgatt G - C C - G C - G G - C G - C C - G T - A T G T T T T C C A T G A A + | + | | A T C T C G G A G G G C G | | | | T T G G A G C T A A GGGGGTC T + G C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |