Sequence ID | >WENV170644640 |
Genome ID | JMBW01047504 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 145 |
End posion on genome | 221 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ggcgcaaggg |
tRNA gene sequence |
CGAGGTGTAGCGCAGTTTGGTAGCGCGCTTGGTTCGGGACCAAGAGGCCCCGGGTTCAAA |
Downstream region at tRNA end position |
tttttatgcc |
Secondary structure (Cloverleaf model) | >WENV170644640 Pro CGG g ACCA tttttatgcc C - G G - C A - T G - C G - C T - A G - C T A T G G C C C A T G A A | | | | | A T C G C G C C G G G C T | | | | T T G G C G C G T A G AGGCC C - G T - A T - A G - C G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |