Sequence ID | >WENV170644645 |
Genome ID | JMBW01047862 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 284 |
End posion on genome | 360 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agcatgtcgt |
tRNA gene sequence |
GGCGGCGTAGCTCAGTTGGTCAGAGCATACGGTTCATACCCGTAGAGTCGCTGGTTCAAA |
Downstream region at tRNA end position |
tgaaactacg |
Secondary structure (Cloverleaf model) | >WENV170644645 Met CAT t ACCA tgaaactacg G + T G - C C - G G - C G - C C - G G - C T A T C G A C C A T G A A | | | | | A T C T C G G C T G G C G | | | | T T G G A G C T C A A GAGTC T - A A - T C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |