Sequence ID | >WENV170644647 |
Genome ID | JMBW01048409 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 107 |
End posion on genome | 183 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ccggaagatc |
tRNA gene sequence |
GGGCTTATAGCTCAGCTGGAAGAGCGCCGCCTTTGCGAGGCGGAGGCCGGGGGGGGTTCA |
Downstream region at tRNA end position |
caatgcaccc |
Secondary structure (Cloverleaf model) | >WENV170644647 Ala TGC c ACtt caatgcaccc G - C G - C G + T C - G T - A T + G A - T T A T C C C C C A C G A A | | | | | A T C T C G G G G G G C G | | | | T T G G A G C A A G AGGCCGGG C - G C - G G - C C - G C - G T A T G T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |