Sequence ID | >WENV170644649 |
Genome ID | JMBW01048654 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 62 |
End posion on genome | 139 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
atgatccggg |
tRNA gene sequence |
GGGGACGTGGCTCAGGGGGGGGAGAGCGCCTGACTCACATTCAGGAGGTCGGAGGTTCAA |
Downstream region at tRNA end position |
atataaattt |
Secondary structure (Cloverleaf model) | >WENV170644649 Val CAC g ACCA atataaattt G - C G - C G - C G - C A - T C - G G - C T A T T C T C C A G G G A G + | | | | A G C T C G G G A G G C G | | | | T T G G A G C G G A G AGGTC C - G C - G T - A G - C A - T C T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |