Sequence ID | >WENV170644653 |
Genome ID | JMBW01049153 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 267 |
End posion on genome | 183 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gcactgcaat |
tRNA gene sequence |
GCGCAGGTGGTGAAATTGGTATACACGCTACTTTGAGGGGGTAGTGCCGGTTACGGCGTG |
Downstream region at tRNA end position |
tgttgattct |
Secondary structure (Cloverleaf model) | >WENV170644653 Leu GAG t ACtt tgttgattct G - C C - G G - C C - G A - T G - C G - C T C T T A C T C A T A A G + | | | | G T A G T G G T G A G C G | | | T T G A C A C T A T G TGCCGGTTACGGCGT C - G T - A A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |