Sequence ID | >WENV170644655 |
Genome ID | JMBW01050021 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 45 |
End posion on genome | 123 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ggttagcaat |
tRNA gene sequence |
GCACACGTGGCCTAGCCTGGATATGGCGGCAGCCTCCTAAGCTGCAAGCCGGGGGGGGTT |
Downstream region at tRNA end position |
taacacatac |
Secondary structure (Cloverleaf model) | >WENV170644655 Arg CCT t GCtt taacacatac G - C C - G A - T C - G A - T C - G G - C T A T C T C C C A C C G A G | + | | | G T T C C G G G G G G C G | | | T T G T G G C A T A G AAGCCGGG G - C C - G A - T G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |