Sequence ID | >WENV170644657 |
Genome ID | JMBW01050130 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 200 |
End posion on genome | 276 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tactcggtgC |
tRNA gene sequence |
GGGGGGGTGGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
tttatgtggt |
Secondary structure (Cloverleaf model) | >WENV170644657 Met CAT C CCAt tttatgtggt G A G + T G - C G G G - C G - C G - C T A T C A T C C A T G A G | | | | | A C C G A G G T A G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |