Sequence ID | >WENV170644659 |
Genome ID | JMBW01050321 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 247 |
End posion on genome | 174 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ttgattatta |
tRNA gene sequence |
GCCGATGTAGCTCAGTTGGCAGAGCAGCTGATTTGTAATCAGCCGGCCGGCGGTTCGAGT |
Downstream region at tRNA end position |
gctcagccag |
Secondary structure (Cloverleaf model) | >WENV170644659 Thr TGT a TCgt gctcagccag G - C C - G C - G G - C A - T T - A G - C T G T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C C A A CGGCC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |