Sequence ID | >WENV170644661 |
Genome ID | JMBW01051515 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 173 |
End posion on genome | 100 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tgcaaagcgc |
tRNA gene sequence |
TGCGGGATGGTGTAGCGGTAGCACACGTGACTCTGGATCATGTAGCCTAGGTTCGAGCCC |
Downstream region at tRNA end position |
agtgatatca |
Secondary structure (Cloverleaf model) | >WENV170644661 Gln CTG c GCCA agtgatatca T - A G - C C - G G - C G - C G - C A - T C G T G A T C C A G A G | | | | | G C T G T G C T A G G C G + | | | T T G G C A C T A A TAGC C - G G + T T - A G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |